Modele touch bel`m

Pour tester des échantillons avec une deuxième méthodologie et détecter des échantillons à faible teneur, nous avons également examiné une aliquote de chaque pool de moustiques pour l`ARN viral à l`aide d`un essai de RT-PCR en temps réel semblable à celui décrit précédemment, 17 sauf avec l`utilisation d`un nouveau jeu d`amorce/sonde (3/3957c/ 3886 FAM) conçu pour détecter les génotypes asiatiques et ECSA de CHIKV (Lanciotti RS, communication personnelle). Les informations de séquence sont les suivantes: CHIKV 3855, GAGDE GGTTACGCAGATAG; CHIKV 3957c – a, TACTGGTGATACATGGTGGTTTC; CHIKV 3957c – b, TGCTGGTGACACATGGTGGTTTC; CHIKV 3886 FAM-a, ACGAGTAATCTGCGTACTGGGACGTA; et CHIKV 3886 FAM-b, ACGAGTCATCTGCGTATTGGGACGCA. L`apprêt 3957c et la sonde 3886 FAM sont produits en reconstituant d`abord les amorces individuelles a et b à 100 μM et les sondes individuelles a et b à 25 μM puis en mélangeant a et b en volumes égaux pour produire les stocks de travail mixtes. L`ARN viral a été extrait d`une aliquote de 100 μL de surnageant prélevé dans chaque pool de moustiques en utilisant le QIAGEN QIAamp virus BioRobot 9604 Kit (Qiagen) sur une plate-forme QIAGEN BioRobot Universal selon le protocole du fabricant. La RT-PCR en temps réel a été utilisée pour l`écran de CHIKV en ajoutant 10 μL de chaque ARN extrait à 50 amorces de pmol et 10 sondes de pmol spécifiques à la région non structurale (nsP2) du génome de CHIKV comme décrit ci-dessus et les réactifs du kit de RT-PCR de la sonde Quantitect de QIAGEN selon aux instructions du fabricant. Des réactions ont été effectuées sur le système de détection de PCR en temps réel CFX96 Touch (Bio-Rad, Hercules, CA) selon les conditions de cyclisme recommandées par le fabricant. Des collections de moustiques ont été faites sur l`île principale de Yap, état de Yap, FSM (figure 1) du 13 au 18 novembre 2013. Les collections ont été réalisées sur 14 sites: 12 résidences cas-patients suspects et 2 sites non associés à la maladie humaine; 11 des 12 résidences cas-patients suspects étaient des maisons familiales individuelles ou élargies, tandis que la résidence de cas-patient restante était située dans un complexe d`appartements (site 14). Une liste de noms et de résidences pour les patients diagnostiqués cliniquement comme ayant une infection CHIKV récente ou en cours par le personnel de l`hôpital d`état de Yap a été fournie à l`équipe entomologique.

Dans chaque foyer, l`équipe entomologique a vérifié que le patient résidait à la résidence et obtenait ensuite la permission de collecter des moustiques. Les 12 résidences cas-patients suspects étaient situées dans trois municipalités (figure 1): 4 résidences à Gagil (sites 10 – 13), 2 résidences à Tomil (sites 2 et 14) et 6 résidences à Rull (sites 4 – 9). En outre, des collections ont été faites sur deux sites non associés à la maladie humaine: la Division de la sécurité publique (département de police et prison), qui est le site 3 et situé à Colonia (Weloy), et le centre de santé communautaire de Tomil (site 1). La plus grande poésie d`amour et les romans les plus puissants ont ceci à leur cœur-et ainsi fait une lettre sincère comme la vôtre, pleine de la folie éternelle et de l`agonie de l`amour non partagé. Les arbres ont été construits sur la base de 33 séquences de nucléotides publiées représentant plusieurs membres de chaque génotype CHIKV. Les séquences ont été alignées à l`aide de l`algorithme du logiciel ClustalW, et les arbres phylogéniques ont été construits sous suppression partielle des lacunes. L`histoire évolutive a été déduite en utilisant la méthode de vraisemblance maximale basée sur le modèle Tamura-nei avec 1 000 itérations bootstrap, et une combinaison de la méthode maximale de parsimonie et MIONJ avec la matrice de distance MCL a été utilisée (MEGA 5). 20, 21 il y avait 11 244 positions dans le jeu de données final.

カテゴリー: 未分類